This is a working overview of LC-MS/MS, written for readers who want more than a one-paragraph summary but less than a textbook.
Reviewed 2025-08-09. Anything still debated is marked as such rather than presented as settled.
NMN is present in small amounts in some foods, including certain vegetables, fruits, and animal products, but food content varies widely and is not well standardized. In laboratory research, NMN is used as a tool compound to study NAD+ metabolism, mitochondrial function, and cellular stress responses. Animal studies have reported changes in NAD+ levels and various physiological measures after NMN administration, but species differences and study designs limit direct extrapolation to humans. Human trials have largely focused on safety, tolerability, and pharmacokinetics, with fewer studies examining clinical endpoints.
Nicotinamide mononucleotide, commonly abbreviated NMN, is a naturally occurring nucleotide. Its structure consists of a nicotinamide ring attached to a ribose sugar that carries a phosphate group. The molecular formula is C11H15N2O8P, and the molar mass is about 334.22 grams per mole. In cells, NMN is an intermediate in the salvage pathway that recycles nicotinamide to maintain NAD+ levels. It is not the same compound as NAD+, although it is a direct precursor in one enzymatic step.
Analytical laboratories identify and quantify NMN using several complementary techniques. High-performance liquid chromatography with ultraviolet detection is widely used for purity and assay work. Liquid chromatography coupled to mass spectrometry provides greater sensitivity and is common for biological matrices. Nuclear magnetic resonance spectroscopy supports structural confirmation and can distinguish related nucleotides. Accurate measurement depends on reference standards, validated methods, and careful sample preparation, especially because NMN can convert to related compounds under some conditions.
Regulatory treatment of NMN varies by jurisdiction and has changed over time. Some countries allow it in dietary supplements, while others treat it as a novel food ingredient requiring safety review. In the United States, the Food and Drug Administration has questioned whether NMN can be lawfully marketed as a dietary supplement because of drug preclusion provisions. Sports organizations have separate rules, and NMN is not currently on the World Anti-Doping Agency prohibited list. These differences create uncertainty for manufacturers, retailers, and researchers seeking consistent legal pathways.
| Property | Value | Notes |
|---|---|---|
| Molecular formula | C11H15N2O8P | Identifies the atoms in the nucleotide |
| Molar mass | 334.22 g/mol | Calculated from the molecular formula |
| Appearance | White to off-white powder | Typical for purified solid material |
| Solubility | Water-soluble | Polar nucleotide; less soluble in nonpolar solvents |
| Common synonyms | Nicotinamide mononucleotide; beta-NMN | beta-NMN refers to the common anomeric form |
Chemically, NMN is described by the molecular formula C11H15N2O8P and a molecular mass near 334.22 g/mol. The beta anomer has a CAS Registry Number of 1094-61-7. It is typically supplied as a white to off-white powder for laboratory use. The molecule carries a phosphate group and a positively charged nicotinamide ring, giving it polar and water-soluble character. These properties influence how it is detected, purified, and stored in research and analytical laboratories.
Nicotinamide mononucleotide, abbreviated NMN, is a nucleotide composed of nicotinamide, ribose, and phosphate. Its structure links nicotinamide to D-ribose 5-phosphate through a glycosidic bond, placing it in the pyridine nucleotide family. The compound exists in alpha and beta anomeric forms, and the beta form is the one used in NAD+ biosynthesis. NMN is not a protein or a hormone; it is a small water-soluble molecule that occurs in living cells as a metabolic intermediate.
Stability testing examines how temperature, humidity, light, and pH affect NMN over time. The compound is generally stored cold, often at minus twenty degrees Celsius or lower, in a desiccated container protected from light. Aqueous solutions tend to be less stable than dry powder because hydrolysis and dephosphorylation can occur, potentially forming nicotinamide riboside or other degradation products. Stress studies may expose samples to heat, acid, base, oxidation, and strong light to identify likely degradation pathways. Results from such studies help define shelf life and handling recommendations, though exact stability depends on formulation and packaging.
Quality control for NMN materials typically includes identity, assay, purity, and impurity profiling. Tests may cover residual solvents, heavy metals, microbial limits, and water content, depending on the intended use and local rules. Impurity profiles can include related substances such as nicotinamide, nicotinamide riboside, and NAD+, which may form during synthesis or storage. Because commercial NMN can be offered as different salts or hydrate forms, a certificate of analysis should state the form and the analytical methods used. Independent verification is relevant because supplement markets vary in testing requirements and enforcement.
Nicotinamide mononucleotide, commonly abbreviated NMN, is a naturally occurring nucleotide. Its structure combines a nicotinamide ring with a ribose sugar and a phosphate group. The compound appears in cells across many organisms as an intermediate in the production of nicotinamide adenine dinucleotide, or NAD+. Because NMN sits close to NAD+ in metabolism, it has drawn interest in biochemistry and aging research. The molecule is not a dietary essential nutrient in the classical sense, and its presence in food is generally low and variable.
NAD+ serves as a coenzyme in redox reactions and as a substrate for enzymes involved in DNA repair and cellular signaling. In the salvage pathway, nicotinamide is converted to NMN by the enzyme NAMPT. NMN is then converted to NAD+ by NMNAT enzymes. A separate route links nicotinamide riboside to NMN through phosphorylation. These pathways maintain NAD+ levels, which can decline with age or metabolic stress in some tissues. The relative contribution of circulating NMN to tissue NAD+ remains an active area of study.
NMN is a polar, water-soluble nucleotide. In solid form it is usually a white to off-white powder. The compound is sensitive to heat, light, moisture, and extremes of pH, and aqueous solutions tend to degrade faster than dry material. Recommended storage for research samples is typically -20 °C or below in a sealed, desiccated container protected from light. Repeated freeze-thaw cycles should be avoided, and these handling practices help maintain identity and purity during laboratory use.
Analytical identification of NMN commonly uses high-performance liquid chromatography with ultraviolet detection, liquid chromatography-mass spectrometry, and nuclear magnetic resonance spectroscopy; HPLC can estimate purity by peak area, while mass spectrometry confirms molecular mass and fragmentation. NMR provides structural confirmation. Because NMN is charged, ion-pairing reagents or hydrophilic interaction liquid chromatography columns can improve retention and peak shape. In biological samples, LC-MS/MS with stable isotope internal standards is often used to quantify NMN and related NAD+ metabolites. Method validation is important because matrix effects and rapid enzymatic interconversion can complicate measurements.
Quality control for NMN typically checks identity, assay purity, residual solvents, heavy metals, and microbial limits, depending on the intended use and market. A certificate of analysis may report appearance, solubility, water content, and storage recommendations. Independent verification can compare chromatographic retention time and mass spectrum against a certified reference standard. Regulatory expectations differ between research chemicals, dietary ingredients, and pharmaceutical products. Impurity profiles and stability data are often requested for product approval, and open questions remain about how best to standardize NMN measurements across laboratories.
== Career == Eke's clinical and research career focuses on the intersection of maternal fetal medicine and pharmacologic research. He serves as the protocol chair for the International Maternal Pediatric Adolescent AIDS Clinical Trials Group (IMPAACT) 2041, a phase I/II clinical trial evaluating the pharmacokinetics and safety of glecaprevir/pibrentasvir initiated during pregnancy among women with hepatitis C, including women co-infected with HIV. He is also involved in longitudinal cohort studies examining cardiovascular and metabolic outcomes in pregnant and postpartum women. His global health work includes contributions to Supporting, Mobilizing, and Accelerating Research for Tuberculosis Elimination (SMART4TB), a tuberculosis research initiative that integrates detection, prevention, and treatment strategies to reduce the burden of TB in high-risk settings. His broader research interests include optimizing drug safety and dosing in pregnancy and lactation, particularly in contexts such as preterm birth, HIV, tuberculosis, sickle cell disease, hypertensive disorders of pregnancy, and opioid use in pregnancy.
In normal-phase TLC, the stationary phase is polar. Silica gel is very common in normal-phase TLC. More polar compounds in a sample mixture interact more strongly with the polar stationary phase. As a result, more-polar compounds move less (resulting in smaller RF) while less-polar compounds move higher up the plate (higher RF). A more-polar mobile phase dissolves polar compounds more. As such, all compounds on the TLC plate move higher up the plate in polar solvent mixtures. "Strong" solvents move compounds higher up the plate, whereas "weak" solvents move them less. If the stationary phase is non-polar, like C18-functionalized silica plates, it is called reverse-phase TLC. In this case, non-polar compounds move less and polar compounds move more. The solvent mixture will also be much more polar than in normal-phase TLC.
=== Personal life === Flory was born in Sterling, Illinois, on June 19, 1910 to Ezra Flory and Martha Brumbaugh. His father worked as a clergyman-educator, and his mother was a school teacher. His ancestors were German Huguenots, who traced their roots back to Alsace. He first gained an interest in science from Carl W Holl, who was a chemistry professor at Manchester College. In 1936, he married Emily Catherine Tabor. They had three children together: Susan Springer, Melinda Groom and Paul John Flory, Jr. His first position was at DuPont with Wallace Carothers. He was posthumously inducted into the Alpha Chi Sigma Hall of Fame in 2002. Flory died on September 9, 1985, following a heart attack. His wife Emily died in 2006 aged 94.
2 P + 6 H2O + 3 Br2 → 6 HBr + 2 H3PO3 H3PO3 + H2O + Br2 → 2 HBr + H3PO4 At room temperature, hydrogen bromide is a colourless gas, like all the hydrogen halides apart from hydrogen fluoride, since hydrogen cannot form strong hydrogen bonds to the large and only mildly electronegative bromine atom; however, weak hydrogen bonding is present in solid crystalline hydrogen bromide at low temperatures, similar to the hydrogen fluoride structure, before disorder begins to prevail as the temperature is raised. Aqueous hydrogen bromide is known as hydrobromic acid, which is a strong acid (pKa = −9) because the hydrogen bonds to bromine are too weak to inhibit dissociation. The HBr/H2O system also involves many hydrates HBr·nH2O for n = 1, 2, 3, 4, and 6, which are essentially salts of bromine anions and hydronium cations. Hydrobromic acid forms an azeotrope with boiling point 124.3 °C at 47.63 g HBr per 100 g solution; thus hydrobromic acid cannot be concentrated beyond this point by distillation. Unlike hydrogen fluoride, anhydrous liquid hydrogen bromide is difficult to work with as a solvent, because its boiling point is low, it has a small liquid range, its dielectric constant is low and it does not dissociate appreciably into H2Br+ and HBr2− ions – the latter, in any case, are much less stable than the bifluoride ions (HF2−) due to the very weak hydrogen bonding between hydrogen and bromine, though its salts with very large and weakly polarising cations such as Cs+ and NR4+ (R = Me, Et, Bun) may still be isolated.
Sources: en.wikipedia.org
== Partition coefficient and log P == The partition coefficient, abbreviated P, is defined as a particular ratio of the concentrations of a solute between the two solvents (a biphase of liquid phases), specifically for un-ionized solutes, and the logarithm of the ratio is thus log P. When one of the solvents is water and the other is a non-polar solvent, then the log P value is a measure of lipophilicity or hydrophobicity. The defined precedent is for the lipophilic and hydrophilic phase types to always be in the numerator and denominator respectively; for example, in a biphasic system of n-octanol (hereafter simply "octanol") and water:
is different for different electrolytes, even at the same ionic strength. There does not need to be any chemical interaction between the species in equilibrium and the background electrolyte, but such interactions might occur in particular cases. For example, phosphates form weak complexes with alkali metals, so, when determining stability constants involving phosphates, such as ATP, the background electrolyte used will be, for example, a tetralkylammonium salt. Another example involves iron(III), which forms weak complexes with halide and other anions, but not with perchlorate ions. When published constants refer to an ionic strength other than the one required for a particular application, they may be adjusted by means of specific ion theory (SIT) and other theories.
the number of molecules, etc. in a given amount of material is a fixed dimensionless quantity that can be expressed simply as a number, not requiring a distinct base unit; the SI thermodynamic mole is irrelevant to analytical chemistry and could cause avoidable costs to advanced economies the mole is not a true metric (i.e. measuring) unit, rather it is a parametric unit, and amount of substance is a parametric base quantity the SI defines numbers of entities as quantities of dimension one, and thus ignores the ontological distinction between entities and units of continuous quantities the mole is often used interchangeably and inconsistently in online sources to refer to both a unit and a quantity without appropriate use of amount of substance causing confusion for novice chemistry students.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
Soldiers were expected to carry their grain rations and cooking utensils in addition to their weaponry, with their backpacks potentially weighing as much as eighty pounds (36 kg). Without the hindrance of oxen and carts, this enabled Macedonian armies to move faster than their opponents. The grain provided to Macedonian soldiers would be wheat, barley, or millet, which were available throughout Asia and could be stored indefinitely when dried. The soldiers would use grinding mills carried by servants to turn the grain into flour, which could then be made into bread, biscuits, and porridge. They also ate various kinds of dried fruits such as dates and figs, which were readily available throughout much of Asia. Whenever possible, they would eat dried meat, salted fish, and shellfish. In ancient China, soldiers of the Han dynasty ate primarily millet and other grains such as wheat, rice, sorghum, etc. Grains could be eaten as a porridge, boiled, made into a bread or flatbread, smashed and fried in a manner similar to modern fried rice and fried noodles, etc. According to Zhao Chongguo, a military commander of the Han dynasty who served in the first century BC, a force of 10,281 men required 27,363 hu of grain and 308 hu of salt each month, requiring a convoy of 1,500 carts for transport. One hu is equivalent to 19.968 liters, meaning that each soldier would have required 51.9 liters of grain and 0.6 liters of salt per month. Another document at Juyan suggests 3.2 hu, or 63.8 liters, of grain.
Sources: en.wikipedia.org
NMN stands for nicotinamide mononucleotide. It is a nucleotide intermediate in the cellular pathway that produces NAD+, a coenzyme involved in energy metabolism and signaling. NMN is not the same compound as NAD+.
NMN is a direct precursor to NAD+ in the salvage pathway. The enzyme NMNAT converts NMN into NAD+ by adding an adenine nucleotide group. This relationship is why NMN is studied in the context of NAD+ decline.
Yes, NMN is produced naturally in cells as part of NAD+ recycling. It also appears in small and variable amounts in some foods. Its natural presence does not by itself establish that supplemental NMN has clinical benefits.
Solid NMN is often kept cool, dry, and protected from light. Long-term storage may use temperatures at or below minus twenty degrees Celsius. Moisture and repeated temperature changes should be avoided.